v20

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis lyrata miR396a stem-loop (aly-MIR396a) URS00007A3024_59689

Automated summary: This pre miRNA sequence is 172 nucleotides long and is found in Arabidopsis lyrata. Annotated by 2 databases (ENA, miRBase). Described in 2 papers. Matches 1 Rfam family (MIR396, RF00648). Arabidopsis lyrata miR396a stem-loop (aly-MIR396a) sequence is a product of aly-MIR396a precursor, MIR396a precurso, MIR396a precursor, MIR396a genes. Found in the Arabidopsis lyrata reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset 

    UCUACGUGACCCUCUCUGUAUUCUUCCACAGCUUUCUUGAACUGCAAAACUUCUUCAGAUUUGUUUUUUUUAUAUAUAUGUCUUACGCAUAAAAUAGUGUUUUUGUUCACAUCUCUGCUCGAUUGAUUUGCGGUUCAAUAAAGCUGUGGGAAGAUACGGACAGAGUCAAAGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.