Automated summary: This pre miRNA sequence is 105 nucleotides long and is found in Sorghum bicolor. Annotated by 4 databases (ENA, Ensembl Plants, miRBase, Rfam). Matches 1 Rfam family (MIR169, RF03311). Sorghum bicolor miR169p stem-loop (sbi-MIR169p) sequence is a product of sbi-MIR169p precursor, MIR169p precurso, MIR169p, ENSRNA049995817, MIR169p precursor genes. Found in the sorghum reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
UUAGCCAAGAAUGGCUUGCCUAUCUCCAUUAUUUGGUUCAUCAGAGGGACCUCUGAUCCCUCAUGAUGGAUGAAAUGUGGAUGAUGGCAGCCCUUCUGGCUAAGU
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.