Automated summary: This pre miRNA sequence is 249 nucleotides long and is found in Sorghum bicolor. Annotated by 3 databases (Ensembl Plants, miRBase, ENA). Matches 1 Rfam family (MIR159, RF00638). Sorghum bicolor miR319 stem-loop (sbi-MIR319a) sequence is a product of sbi-MIR319a precursor, ENSRNA049996604, MIR319a precursor, MIR319a precurso, MIR319a genes. Found in the sorghum reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
CUGCCGCCAUGGUUGUGAUAUGGCCGGAUGGAAGAGAGCGUCCUUCAGUCCACUCAGGGGCGGUGCUAGGGUCGAAUUAGCUGCCGACUCAUUCACCCACAUGCCAAGCAAACGGCCAUGGAAACGAGCUAGCUUUGCAGAUGAGUGAAUGAAGCGGGAGGUAAAAGCUUCGAUCUCGCACCAUCUUUGCUUGGACUGAAGGGUGCUCCCUCCUCCCCUCCUUAAUUGUUUACUUUACCCAUGGCGCAG
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.