Automated summary: This pre miRNA sequence is 83 nucleotides long and is found in Strongylocentrotus purpuratus. Annotated by 3 databases (ENA, RefSeq, miRBase). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-4847, RF03574). Strongylocentrotus purpuratus microRNA spu-mir-4847 precursor sequence is a product of 4847, spu-mir-4847 precursor, mir-4847, mir-4847 precursor, Mir4847, mir-4847 precurso genes. Found in the Strongylocentrotus purpuratus reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
UUUCACCUCAUAAUGAUGGCGCGGUGCGGUGCGAUGUGAUAUCAAAAAAUUCGCUCUCAUUCGCCAUCAUUCUUAGGUGUAGU
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.