Automated summary: This pre miRNA sequence is 121 nucleotides long and is found in Sorghum bicolor. Annotated by 3 databases (Ensembl Plants, ENA, miRBase). Has a conserved secondary structure or a structured region. Sorghum bicolor miR156i stem-loop (sbi-MIR156i) sequence is a product of ENSRNA049995859, sbi-MIR156i precursor, MIR156i, MIR156i precurso, MIR156i precursor genes. Found in the sorghum reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
ACUGACAGAAGAGAGUGAGCACACAGCGGGCAGACUGCAUCGAUCUGAACCGAGACGACGCAAGUAGGAAUGAUGAUGAUGAUGCAGCUGCUGCUGCGUGCUCACUUCUCUCUCUGUCAGA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.