Automated summary: This pre miRNA sequence is 101 nucleotides long and is found in Strongylocentrotus purpuratus. Annotated by 4 databases (ENA, RefSeq, Ensembl Metazoa, miRBase). Has a conserved secondary structure or a structured region. Strongylocentrotus purpuratus microRNA spu-mir-252a precursor sequence is a product of Mir252a, 252, GeneID_100314433, spu-mir-252a precursor, mir-252a precursor, mir-252a precurso, 252a, mir-252a genes. Found in the Strongylocentrotus purpuratus reference genome.
This sequence is found in {{ locations.length }} genome
Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
---|---|---|---|---|---|---|---|---|
Loading genome locations... | ||||||||
Failed to load data from server | ||||||||
No genome locations known | ||||||||
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
CACGUGACUAUGUUCCGUCCUAAGUACUAGUGCCGUAGGUUAACUGAGAAGGAAAGUGAAGCUAGACUAUAGCUUCUCAGACCUGUAGUACUAGUACUUAA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.