Automated summary: This pre miRNA sequence is 113 nucleotides long and is found in Arabidopsis thaliana. Annotated by 4 databases (ENA, RefSeq, Ensembl Plants, miRBase). Matches 1 Rfam family (MIR164, RF00647). Arabidopsis thaliana miR164a stem-loop (ath-MIR164a) sequence is a product of AT2G47585, MIR164a precursor, MIR164a precurso, MIR164a, ath-MIR164a precursor genes. Found in the Arabidopsis thaliana reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GGGUGAGAAUCUCCAUGUUGGAGAAGCAGGGCACGUGCAAACCAACAAACACGAAAUCCGUCUCAUUUGCUUAUUUGCACGUACUUAACUUCUCCAACAUGAGCUCUUCACCC
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.