Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-8485 URS000076B539_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-8485: Hsa-mir-8485 is a microRNA (miRNA) that has been identified as one of the top 10 miRNAs associated with differentially expressed genes (DEGs) [PMC9793038]. Through miRNA target prediction, it has been determined that hsa-mir-8485 regulates 1055 genes [PMC9463341]. Furthermore, it has been observed that acute exercise can alter the levels of hsa-mir-8485 in urinary extracellular vesicles (EVs) [PMC9463341]. In a study, hsa-mir-8485 was identified as one of the hub nodes in a network analysis, along with other miRNAs such as hsa-miR-26b-5p and hsa-miR-940 [PMC6323221]. Additionally, it was found that the expression levels of hsa-mir-8485 were downregulated one hour after a 20-minute submaximal running test (SRT) [PMC9463341].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACACACACACACACACGUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications