Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3158 precursor (hsa-mir-3158-1) URS000075F122_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR3158-1: MIR3158-1 is a gene that is found in cases of Split-Hand/Foot Malformation (SHFM) and is duplicated in the majority of SHFM cases [PMC5003447]. In SHFM cases without microarray data, the shortest duplication contains MIR3158-1, along with other genes such as BTRC, POLL, DPCD, MIR3158-2, and a portion of FBXW4 [PMC5003447]. This duplication was found in Patient 35 and 40 [PMC5003447]. In the majority of SHFM cases with microarray data, the duplication also includes LBX1, BTRC, POLL, DPCD, MIR3158-2 and FBXW4 or a portion of FBXW4 [PMC5003447]. The duplicated segment in these cases extends from centromeric to telomeric direction [PMC5003447]. Patients 30 and 31 have a centromeric duplicated segment containing TLX1NB and TLX1 and a telomeric duplicated segment containing BTRC, POLL, DPCD, MIR3158-1,MIR3158-2,and a portion of FBXW4 (exon 9–7) [PMC5003447]. In some SHFM cases with two discontinuous duplications at 10q24.31–q24.32 (Patient 12–15), one duplication contains LBX1,BTRC,POLL,DPCD,MIR3158-1,MIR3158-2,and a portion of FBXW4 from centromeric to telomeric direction while the other contains LINC01514,LBX1,BTRC,POLL,DPCD,MIR3158-1,MIR3158-2,and a portion of FBXW4 from centromeric to telomeric direction [PMC5003447]. In Patient 18, a 241.59 kb duplication at 10q24.31-q24.32 containing a portion of BTRC, the entire POLL, DPCD, MIR3158-1, MIR3158-2, and a portion of FBXW4 was found [PMC5003447]. This patient exhibited certain phenotypic features associated with SHFM [PMC5003447]. In Patient 1, a 514 kb duplication at 10q24.31-10q24.32 containing LBX1,BTRC,POLL,DPCD,MIR3158-1,MIR3158-2,and FBXW4 was observed [PMC5003447].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUUCAGGCCGGUCCUGCAGAGAGGAAGCCCUUCUGCUUACAGGUAUUGGAAGGGCUUCCUCUCUGCAGGACCGGCCUGAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications