Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus (house mouse) microRNA mmu-mir-411 precursor secondary structure diagram

Mus musculus (house mouse) microRNA mmu-mir-411 precursor URS000075EFB1_10090

Automated summary: This pre miRNA sequence is 82 nucleotides long and is found in Mus musculus. Annotated by 6 databases (Ensembl, RefSeq, miRBase, MGI, Ensembl/GENCODE, ENA). Described in 20 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-154, RF00641). Mus musculus (house mouse) microRNA mmu-mir-411 precursor sequence is a product of mir-411 precurso, mir-411, mmu-mir-411 precursor, mir-411 precursor, Mir411 genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGUACUUGGAGAGAUAGUAGACCGUAUAGCGUACGCUUUAUCUGUGACGUAUGUAACACGGUCCACUAACCCUCAGUAUCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 54 other species

    1. Ailuropoda melanoleuca (giant panda) miRNA
    2. Balaenoptera musculus miRNA
    3. Bison bison bison (American bison) miRNA
    4. Bos grunniens (domestic yak) miRNA
    5. Bos indicus x Bos taurus miRNA
    6. Bos mutus miRNA
    7. Bos taurus (cattle) microRNA bta-mir-411a precursor
    8. Camelus dromedarius (Arabian camel) miRNA
    9. Canis lupus dingo miRNA
    10. Canis lupus familiaris miRNA
    11. Cavia aperea (Brazilian guinea pig) miRNA
    12. Cavia porcellus miRNA
    13. Cervus hanglu yarkandensis (Yarkand deer) miRNA
    14. Chinchilla lanigera (Long-tailed chinchilla) miRNA
    15. Choloepus hoffmanni (Hoffmann's two-fingered sloth) miRNA
    16. Cricetulus griseus (Chinese hamster) microRNA 411
    17. Dasypus novemcinctus (nine-banded armadillo) miRNA
    18. Delphinapterus leucas miRNA
    19. Dipodomys ordii miRNA
    20. Equus caballus (horse) microRNA eca-mir-411 precursor
    21. Felis catus (domestic cat) miRNA
    22. Fukomys damarensis (Damara mole rat) miRNA
    23. Heterocephalus glaber miRNA
    24. Jaculus jaculus miRNA
    25. Loxodonta africana miRNA
    26. Lynx canadensis (Canada lynx) miRNA
    27. Macaca mulatta microRNA mml-mir-411 precursor
    28. Mesocricetus auratus (Golden Hamster) microRNA 411 (Mir411)
    29. Microtus ochrogaster microRNA 411
    30. Monodon monoceros (narwhal) miRNA
    31. Moschus moschiferus miRNA
    32. Mus caroli microRNA 411
    33. Mus pahari microRNA 411
    34. Mus spretus microRNA 411
    35. Mustela putorius furo (Domestic ferret) miRNA
    36. Myotis lucifugus miRNA
    37. Nannospalax galili miRNA
    38. Neovison vison miRNA
    39. Octodon degus (Degu) miRNA
    40. Panthera leo (lion) miRNA
    41. Phocoena sinus (vaquita) miRNA
    42. Physeter catodon (sperm whale) miRNA
    43. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA
    44. Procavia capensis (cape rock hyrax) miRNA
    45. Pteropus vampyrus miRNA
    46. Rhinolophus ferrumequinum (greater horseshoe bat) miRNA
    47. Suricata suricatta (meerkat) miRNA
    48. Sus scrofa (pig) miRNA (MIR411, ssc-mir-411)
    49. Tursiops truncatus (bottlenosed dolphin) miRNA
    50. Ursus americanus (American black bear) miRNA
    51. Ursus maritimus (Polar bear) miRNA
    52. Ursus thibetanus thibetanus (Asiatic black bear) miRNA
    53. Vicugna pacos (alpaca) miRNA
    54. Vulpes vulpes miRNA
    55. Zalophus californianus miRNA
    2D structure New