Automated summary: This pre miRNA sequence is 82 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (HGNC, MalaCards, GeneCards, Ensembl, ENA, RefSeq, miRBase). Homo sapiens (human) microRNA hsa-mir-3162 precursor sequence is a product of MIR3162, hsa-mir-3162 precursor, mir-3162, mir-3162 precurso, ENSG00000264559.1, mir-3162 precursor genes. Found in the Homo sapiens reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
CUGACUUUUUUAGGGAGUAGAAGGGUGGGGAGCAUGAACAAUGUUUCUCACUCCCUACCCCUCCACUCCCCAAAAAAGUCAG
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.