Octodon degus (Degu) microRNA 379 (ENSODEG00000021900.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Octodon degus (Degu) microRNA 379 (ENSODEG00000021900.1) URS000075EEE5_10160

67 nucleotides
1 database (Ensembl)
Found in 9 other species
20 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

AGAGAUGGUAGACUAUGGAACGUAGGCGUUAUGAUUUCUGACCUAUGUAACAUGGUCCACUAACUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Cebus imitator microRNA 379 (ENSCCAG00000006779.1)
Gorilla gorilla gorilla microRNA 379 (ENSGGOG00000031850.2)
Gorilla gorilla (western gorilla) mir-379 microRNA precursor family
Homo sapiens (human) microRNA hsa-mir-379 precursor
Oryctolagus cuniculus (rabbit) mir-379 microRNA precursor family
Otolemur garnettii (small-eared galago) mir-379 microRNA precursor family
Pan paniscus microRNA 379 (ENSPPAG00000015744.1)
Pan troglodytes ptr-mir-379 (ENSPTRG00000027799.3)
Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 379 (ENSSBOG00000000356.1)

Publications