Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pteropus vampyrus (large flying fox) microRNA 193b (MIR193B) secondary structure diagram

Pteropus vampyrus (large flying fox) microRNA 193b (MIR193B) URS000075EEDD_132908

Automated summary: This pre miRNA sequence is 83 nucleotides long and is found in Pteropus vampyrus. Annotated by 1 database (Ensembl). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-193, RF01895). Pteropus vampyrus (large flying fox) microRNA 193b (MIR193B) sequence is a product of MIR193B gene. Found in the large flying fox reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUGGUCCCAGAAUCGGGGUUUUGAGGGCGAGAUGAGUUUAUGUUUUAUCCAACUGGCCCACAAAGUCCCGCUUUUGGGGUCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 10 other species

    1. Ailuropoda melanoleuca miRNA
    2. Bos taurus (cattle) microRNA bta-mir-193b precursor
    3. Capra hircus (Goat) chi-mir-193a
    4. Carlito syrichta (Philippine tarsier) microRNA 193b (MIR193B)
    5. Microcebus murinus miRNA
    6. Mustela putorius furo (Domestic ferret) microRNA 193b (MIR193B)
    7. Myotis lucifugus microRNA 193b (MIR193B)
    8. Otolemur garnettii (small-eared galago) microRNA 193b (MIR193B)
    9. Ovis aries miRNA
    10. Panthera pardus microRNA 193b
    11. Panthera tigris altaica (Tiger) microRNA 193b (MIR193B)
    12. Tursiops truncatus (bottlenosed dolphin) microRNA 193b (MIR193B)
    2D structure New