Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-489-3p URS000075EE66_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-489: Rno-mir-489 is a down-regulated microRNA (miRNA) that is associated with the up-regulation of mRNA expression of its predicted target gene, Bcl10 [PMC2974699]. It is also predicted to regulate a vast number of genes, making speculation on its function difficult [PMC3386237]. Rno-mir-489 is present within the Calcr gene [PMC3386237]. Its expression is most noticeable in the theca and cumulus cells of FC [PMC3682887]. In a study examining aberrantly expressed miRNAs, rno-mir-489 was found to be down-regulated in samples from animals treated with 2-mg/kg [PMC2974699]. Another down-regulated miRNA, rno-let-7e*, was also consistent with the up-regulation of its predicted target gene, Ccna2 [PMC2974699]. Rno-mir-489 and rno-let-7e* were found to be predicted targets of Ccna2 and Bcl10, respectively [PMC2974699]. In addition to rno-mir-489, rno-miR653 was also found within the Calcr gene [PMC3386237]. These findings suggest that rno-mir-489 may play a role in regulating gene expression and could be involved in various biological processes. However, further research is needed to fully understand its function.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGACAUCACAUAUAUGGCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications