Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-663b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-663b precursor URS000075EE28_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR663B: MIR663B is a down-regulated microRNA located in the intron of ANKDR30BL, and it is associated with various biological processes and diseases. In Immunity-H, genes such as SPRR3, CTGF, E2F5, MIR663B, and others have significantly higher mutation rates compared to Immunity-L [PMC9855412]. Previous studies have shown that silencing or knockout of POLRMT, a gene with higher mutation rates in Immunity-H, can inhibit cell proliferation and promote apoptosis [PMC9855412]. In patients with down-regulated MIR663B expression, there is a significant increase in the expression of genes associated with cell proliferation and migration [PMC7439310]. MIR663B has been found to regulate the expression of CCL17, CD40, and PIK3CD in chronic lymphocytic leukemia [PMC7439310]. Additionally, high expression of MIR663B is correlated with distant metastasis and advanced tumor grading in endometrial cancer patients [PMC5796233]. In endometrial cancer cells, PS suppresses MIR663B expression which plays an oncogenic role by upregulating pro-survival Bcl-2 and reducing apoptosis [PMC5796233]. The gene cluster on chromosome 2 contains an area between RNA5-8SP5 and MIR663B genes that includes Exp-MiBRs [PMC6792129]. Although there was no significant change in the expression of any miRNAs over time, there was a trend for an increase in MIR663B expression [PMC6416171].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUGCCGAGGGCCGUCCGGCAUCCUAGGCGGGUCGCUGCGGUACCUCCCUCCUGUCUGUGGCGGUGGGAUCCCGUGGCCGUGUUUUCCUGGUGGCCCGGCCGUGCCUGAGGUUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications