Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) cancer susceptibility 9 (CASC9) URS000075EDE0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CASC9: CASC9 is a long non-coding RNA (lncRNA) that has been implicated in various types of cancer, including esophageal squamous cell carcinoma (ESCC), nasopharyngeal carcinoma, oral squamous cell carcinoma (OSCC), lung squamous cell carcinoma, breast cancer, gastric cancer, hepatocellular carcinoma (HCC), pancreatic ductal adenocarcinoma, colorectal cancer (CRC), ovarian cancer (OC), and cervical cancer [PMC7444322]. CASC9 has been shown to play a role in tumor progression and metastasis [PMC5362493]. It has been found to be mainly expressed in normal colon and bladder tissues [PMC6560732]. CASC9 depletion has been shown to increase autophagy by inhibiting the AKT/mTOR signaling pathway in OSCC cells [PMC6381212]. It has also been demonstrated that CASC9 overexpression promotes the stability of HK2 mRNA in U251 cells [PMC8514511]. CASC9 expression is positively regulated by HIF-1α, suggesting a positive feedback loop between CASC9 and HIF-1α [PMC6827505]. Additionally, higher levels of CASC9 have been associated with lower HCC recurrence after surgery, suggesting its potential as a prognostic biomarker for recurrence [PMC6471845]. In summary, CASC9 is an lncRNA that is overexpressed in various types of cancer and plays a role in tumor progression and metastasis. It is mainly expressed in normal colon and bladder tissues. Depletion of CASC9 increases autophagy by inhibiting the AKT/mTOR signaling pathway. Its expression is positively regulated by HIF-1α. Higher levels of CASC9 are associated with lower HCC recurrence after surgery.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGAUGAAGCCGGUACCUCAGAUGGAAAUGCGGAAAUCACCGUCUUCUGUGUCGCUCAGGCUGGGAGCUGUAGACCGGAGCUGUUCCUAUUCGGCCAUCUUGGCUCCUCUCCCUCUUUAAAGUGAUUGCUCACUGAUGCCUUAUCUAGUUCUCUUGGUGAGGUCAUGUUUUCCUGGAUGGUCUUGGUGUUUGUGGAUGUUCAUCAAUGUCAGGGCAUUGAGAAGUUAGAAUGUGAUUUUGAAGAAAGGAGGAAAGAUGUGAAAAGUGAUUGGUCAGCCACAUUCAUGGUGUUGAGAAAAGAAUUUGCUUUUCUGGAACAUAGCCUGUGAUAGCAGAACAACACCUGGCAAGAAACAGGUUAUGUUUGGCUGGAGAGUCAUUGGCACUAUCAAGAAAUAUUAAAGUGUAGAUUUGAGAGAGGAGGAGAAAGACCCAAGCAAAAUUGAAAACCAGGUGGGACCCAGACAGCAGCAAAGCAAUGGAAGCAUGUAUUUUGGUCAAUAUAGAGUUAAUACACAAUUUUGCCCCUCUUCUUCUGAUCAUGGGACUCAUAUUACCAGUCUUCACAUUUCCUUUAAAUUCAGGAAUCAGGAAGAAUUUCCAGAGUUUGCAGAUGGACACAUUUGCUGCUUCCAUUCUAAACAUAAGUUAGAAGAACCUUUCAACUGGAUUCCAACUUUAAUAUGUCACAAACAUAAAAAAGAAAGCUAUUUCCUGGACUUUUCUUCAUUAGAAAUUAAUAGAUUGUCAAUUGGCAUAGGGAAAAGAUAAUCAACAGAUGCCAACCCCAAGUUAACAGAAAUGCUAAAAUUAUAAGACAAAGACUUCAAAAUAGCUAUUUUAAUUUUGCCUAGUGAGGUAAAUGCAAACAUGCUCACUAUGAAUGAAAACAGGUAAUCUCAGCAGUCAUGUAAACUAUAAAAAUAAGCAAAUAUAAAUUUUAGAAUUAAAACACAAUAUCUAAAAAUAAAUUCACCUGAUAUUCUCAAUAGAAAAAAUGGUAAUGCAGAGAAAAAUGUAUGAAAAUAUGGCAAUUUGAAGAAGAGAGAAGAGAUCAAUAAAAUAAAUAAGUAUAUCCUUGGAGACCUGUGGAUGUUUUUUGAAAAGUGAAUCAUGUAAGUAAUUGAAGUCCCAGAAGAAAAGAAAAGAAGAGGAUGAGCAGAAAAAAAUUUCUGAAAAAAUAUCUGAAAGCUUAAACACUAUAAUGAAAGACACACAUUUACAAACUCAAGAAGUUUAGUAAACCAAAAACAAUAAAAUCAAAGAGAACUGUGCCAAGCGACAUCAUUUUCAACCUGCUGAAGAUCUUGACAGCAGUCAGAGAAAAAAGACACACUUAUUACACAGAGAGGAACAAUACAUUAAAUACUAGCACACUUCUCAUCAGAGAUCAUUAAGCCCAGAAGACAGUGGAAUGAGAUCUUUAAAGUGCUGAAAUAAAAUAAAUGUUGAUUAAAAAAUUCUAUAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications