Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-4429 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-4429 precursor URS000075EB92_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4429: MIR4429 is a microRNA that has been found to be associated with tumor growth suppression and is detected in malignant struma ovarii [PMC10047136]. It has been suggested that MIR4429 targets METTL3 and prevents the m6A modification of SEC62 mRNA, leading to the destabilization of SEC62 mRNA [PMC7272606]. In patients with stroke, MIR4429 levels are lower in peripheral blood mononuclear cells, while in non-small cell lung cancer (NSCLC) patients, MIR4429 levels are significantly lower compared to healthy controls [PMC7123062] [PMC9392976]. NSCLC patients with low MIR4429 levels have been found to have poor overall survival [PMC9392976]. The expression levels of MIR4429 in circulation may be influenced by the VAS/SAT ratio and activity in adipose tissue [PMC6240145]. In genome-wide analyses, MIR4429 has been associated with endometriosis and various types of ovarian cancer (HGSOC, CCOC) [PMC9040176]. Additionally, it has been shown that MIR4429 inhibits gastric cancer progression by targeting METTL3 and hindering m6A-induced stabilization of SEC62 mRNA [PMC6920212]. References: - PMC10047136 - PMC7272606 - PMC7123062 - PMC9392976 - PMC6240145 - PMC9040176 - PMC6920212

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGGAGAAAAGCUGGGCUGAGAGGCGACUGGUGUCUAAUUUGUUUGUCUCUCCAACUCAGACUGCCUGGCCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications