v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) GLIS3 antisense RNA 1 (GLIS3-AS1) URS000075EB77_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

GLIS3-AS1: GLIS3-AS1 is a long non-coding RNA (lncRNA) that has been identified as part of an 8-lncRNA signature that can partially discriminate between malignant and benign Intraductal Papillary Mucinous Neoplasms of the Pancreas (IPMNs) [PMC5585319]. It has also been found to be up-regulated in patients with a high-risk score and is expressed at high levels in low-risk patients [PMC6930402]. GLIS3-AS1, along with other lncRNAs, has been proposed as a more accurate method for distinguishing malignant IPMNs from benign ones compared to standard clinical and radiologic features [PMC6708875]. GLIS3-AS1 is included in a prognosis model for IPMNs along with other lncRNAs [PMC9012522]. In the context of prognosis for papillary renal cell carcinoma (pRCC), GLIS3-AS1 is one of six lncRNAs that are positively connected with overall survival [PMC6708875]. Additionally, GLIS3-AS1 has been found to be correlated with 17 protein-coding genes in the yellow module of a study on pancreatic cancer [PMC8817105]. These findings highlight the potential role of GLIS3-AS1 as a biomarker for distinguishing between malignant and benign IPMNs, as well as its association with prognosis in pRCC and its correlation with protein-coding genes in pancreatic cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUAAAAAAGGGUAGUUGUGGUUGGCUCUGCCUUUGCUGUCUUUACCUGAAUAGAGGUCAGGCCCGGGUCCAGGGGAGCGUCCCACGGUCCCUUCAGCAGCAGCAUCUCUAGGGGAAGUGGCCGGCUGCAGGGACUGCACGGUGAGGCAAUCUGUGAGCAGGUCUGGAUGGAGCUCUGUGCUGGACCGCAACUAAGAGGACAAAACGGAAGAGACAUCGAUAAGGAGAGCCGGUCCUUGGAAUAUUUUCCUGGGAAGGCAUCAUGCUCUAUCAGUGCAACUCAGCCCACAAAAAUUUAUCAAGCAGCAACUACGGGUCCUCUGAACGGGCCACACCACGGUUGAGCCAUUGUGACCCCUGCGACACACAGGUCCAGGCCUCCUGGAGUCACAAAGCUUUGAGCAACAGGAGAACCACUAAAGAAGAAGAAACAGCUAGCUCCUGCCUUAACUGAUUAACCGAACUUGCAACAUUCCACCAUUGUGAUAUGUUCCUGCCCUACCCUAAAUAAUCAAUCGGCCUUGUGAUAUCCUGCCAUGUGAACUCCCUCCACCUCGUGACUACGCACCUUGUGACAUUCUUCCCCUGCCCGAAAAGACUGCCCCAACUGUAACCUUCCACUACCUAUCCCAAACCUAUAAAACCAGUUCCACUCCCACCGCCCUUCGCUGACUCCCUUUUCAGACUCAGCCCGCUCGCACCGGAGUGAAUAAACAGCCUUGUUGCUCACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications