v20

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays zma-miR156e-3p URS000075EB5D_4577

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Zea mays. Annotated by 3 databases (miRBase, RefSeq, ENA). Described in 4 papers. Zea mays zma-miR156e-3p sequence is a product of miR156e, miR156, zma-miR156e, miR156e-3p, MIR156e, zma-miR156e-3p genes. Found in the Zea mays reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset 

    GCUCACUGCUCUCUCUGUCAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    Publications New