Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3686 precursor URS000075EB23_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR3686: MIR3686 is a microRNA that has been identified as a potential regulator for PLK1, a key regulator for cell mitosis [1]. In "gain of function" assays, inhibiting MIR3686 enhanced cell proliferation [1]. The 3′UTR of PLK1 mRNA, which contains the MIR3686 target sequence, was cloned to generate a PLK reporter [1]. In PANC1 cells, downregulation of MIR3686 was correlated with an increase in PLK1 mRNA expression [1]. Transfection of MIR3686 mimic inhibited the proliferation and colony formation of PANC1 cells [1]. The inhibition of PLK1 by MIR3686 could be achieved by increasing the dose or transfecting the cells multiple times [1]. In cell invasion assays, moderate inhibition of invasion was observed in MIR3686 transfected cells [1]. The expression level of MIR3686 in HPDE67 cells was higher compared to PANC1 cells and downregulation of MIR3686 could enhance cell proliferation and clone formation in HPDE67 cells [1].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCACCUCAUUCAUUUACCUUCUCUUACAGAUCACUUUUCUGCACUGGACAGUGAUCUGUAAGAGAAAGUAAAUGAAAGAGGUGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications