Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Zea mays miR166d stem-loop (zma-MIR166d) secondary structure diagram

Zea mays miR166d stem-loop (zma-MIR166d) URS000075EAC1_4577

Automated summary: This pre miRNA sequence is 104 nucleotides long and is found in Zea mays. Annotated by 3 databases (ENA, RefSeq, miRBase). Described in 5 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-166, RF00075). Zea mays miR166d stem-loop (zma-MIR166d) sequence is a product of MIR166d precurso, MIR166d precursor, zma-MIR166d precursor, MIR166d genes. Found in the Zea mays reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUGGAAUGUUGUCUGGUUCAAGGUCUUUUGCUUUGUGAUCCAUCUGUGUAGAGCUUCUAAGUAUUCCUUGGAUCUGCAAGAUCUCGGACCAGGCUUCAUUCCCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    2D structure Publications New