Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4802 precursor URS000075EA36_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4802: MIR4802 is a microRNA that is downregulated by LPS/TLR4 interactions, leading to increased autophagy and enhanced cell resistance to therapy [PMC9315032]. In colorectal cancer (CRC), Fusobacterium nucleatum plays a role in chemotherapy resistance by coordinating TLR4-MyD88, miR18a, MIR4802, and ULK1/ATG7 autophagy networks [PMC9411745]. F. nucleatum downregulates miR-18a and MIR4802 to activate the autophagy pathway and promote chemoresistance in CRC [PMC9718533]. The bacterium also activates the TLR4/MYD88 and ULK1/ATG7 signals, which decrease the expression of miR18* and MIR4802, respectively, contributing to CRC cell proliferation and chemo-resistance mechanisms [PMC9959216]. Additionally, F. nucleatum promotes chemoresistance by activating the autophagy pathway through downregulation of miR-18a and MIR4802 [PMC8106554]. Overall, these findings highlight the important role of F. nucleatum in controlling CRC chemo-resistance through its interactions with microRNAs (miR-18a and MIR4802) as well as the TLR4/MYD88 and ULK1/ATG7 networks [PMC9959216].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGACUGGCUUGUAUGGAGGUUCUAGACCAUGUUAGUGUUCAAGUCUACAUGGAUGGAAACCUUCAAGCAGGCCAAGCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications