Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-489 precursor URS000075EA26_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR489: MIR489 is a microRNA that has been identified in various studies as playing a role in different biological processes. It has been found to be differentially expressed in paired samples and shares similar regulatory trends with other miRNAs [PMC3398046]. MIR489 is necessary for maintaining the quiescent state of satellite cells by post-transcriptionally repressing the oncogene Dek [PMC6303387]. It has also been implicated in the regulation of quiescence in MuSCs [PMC9715903]. MIR489 has been shown to be downregulated in certain conditions, such as cardiac hypertrophy, where it is regulated by the lncRNA cardiac hypertrophy-related factor (chrf) [PMC7123062]. Additionally, MIR489 has been identified as a positive modulator of adult stem cell quiescence and is involved in the post-transcriptional suppression of the oncogene Dek [PMC6446479]. In breast cancer cell lines, overexpression of MIR489 leads to down-regulation of HER2 [PMC4951289]. Downregulation of miR200c and MIR489 has been associated with better prognosis, while upregulation of miR484 and miR4443 is associated with better prognosis [PMC7827149]. Furthermore, targeting MIR489 may have therapeutic potential for certain conditions such as kidney ischemia and cardiac hypertrophy [PMC8001091] [PMC6562440] . However, it should be noted that deletion or knockout of certain genes may not necessarily affect the expression or presence of intronic MIR489 or other miRNAs such as miR208.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGGCAGCUUGGUGGUCGUAUGUGUGACGCCAUUUACUUGAACCUUUAGGAGUGACAUCACAUAUACGGCAGCUAAACUGCUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications