v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) PCNA antisense RNA 1 (PCNA-AS1) URS000075EA0B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

PCNA-AS1: PCNA-AS1, a long non-coding antisense RNA of PCNA, has been implicated in esophageal cancer progression [PMC9490863]. The association between PCNA-AS1 and PCNA in esophageal squamous cell carcinoma (ESCC) tissues was examined by assessing the expression pattern of PCNA [PMC9490863]. Several long non-coding RNAs (lncRNAs), including MALAT1, PCNA-AS1, and HOTTIP, have been found to play a role in hepatocellular carcinoma (HCC) progression [PMC4990377]. ZNFX1-AS1, an lncRNA associated with various cancers such as breast, gastric, and colorectal cancer, is significantly downregulated in breast cancer and may serve as a potential biomarker for this type of cancer [PMC4990377]. However, its role in HCC and other cancers remains largely unknown [PMC4990377].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUUCACGCCCAUGGCCAGGUUGCGGUCGCAGCGGUAGGUGUCGAAGCCCUCAGACCGCAGGGUGAGCUGCACCAAAGAGACGUGGGACGAGUCCAUGCUCUGCAGGUUUACACCGCUGGAGCUAAUAUCCCAGCAGGCCUCGUUGAUGAGGUCCUUGAGUGCCUCCAACACCUUCUUGAGGAUGGAGCCCUGGACCAGGCGCGCCUCGAACAUGGUGGCGGAGUGGCAACAACGCCGCUACAGGCAGGCGGGAAGGAGGAAAGUCUAGCUGGUUUCGGCUUCAGGAGCCUCAGAGCGAGCGGGCGAACGUCGCGACGACCGGCUGAGACCUAGAAAGACAACGACCACUCUGCUACGCCUGCAACCGUUUAAUGCCGCCGCGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications