Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-199b precursor URS000075E907_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR199B: MIR199B is a type of microRNA that has been studied in various contexts. Over-expression of MIR199B did not significantly affect the levels of HIF-1α mRNA and NFκB mRNA and protein [PMC3645752]. The PCR primers for mature MIR199B were designed and the product length was determined to be 66 bp [PMC3645752]. The deficiency of MIR199B led to the elimination of the protective function of mmu-miR-199b-3p, resulting in increased levels of ACR, BUN, Cr, and proteinuria [PMC8257373]. Interestingly, higher levels of MIR199B were found in the plasma of patients infected with SARS-CoV2 virus [PMC9677482]. In breast cancer, MIR199B was found to be up-regulated along with miR26b, while miR126, miR146a, miR34a were down-regulated [PMC3828615]. The potential role of MIR199B in VEGF transcriptional activation and secretion has been investigated through additional experiments [PMC4737258]. In cancer stem cells and medulloblastoma growth inhibition experiments, inhibition of transcription factor HES1 by MIR199B repressed pluripotency [PMC3645752]. Overexpression of certain microRNAs including MIR199B was associated with shorter survival PFS in certain patients while increased expression of other microRNAs was observed only in patients with intermediate and high cytogenetic risk [PMC6183594].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAGAGGACACCUCCACUCCGUCUACCCAGUGUUUAGACUAUCUGUUCAGGACUCCCAAAUUGUACAGUAGUCUGCACAUUGGUUAGGCUGGGCUGGGUUAGACCCUCGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 41 other species

  1. Ailuropoda melanoleuca (giant panda) microRNA 199b (ENSAMEG00000022806.2)
  2. Aotus nancymaae miRNA (ENSANAG00000009792.1)
  3. Callithrix jacchus miRNA (ENSCJAG00000027318.3)
  4. Canis lupus dingo (dingo) microRNA 199b (ENSCAFG00020017089.1)
  5. Canis lupus familiaris miRNA (ENSCAFG00000020613.2, ENSCAFG00030013729.1, ENSCAFG00040014617.1, ENSCAFG00845029486.1)
  6. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000032361.1)
  7. Cavia aperea (Brazilian guinea pig) microRNA 199b (ENSCAPG00000001689.1)
  8. Cavia porcellus (domestic guinea pig) microRNA 199b (ENSCPOG00000016261.3)
  9. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000005185.1)
  10. Chinchilla lanigera miRNA (ENSCLAG00000020829.1)
  11. Chlorocebus sabaeus (African green monkey) microRNA 199b (ENSCSAG00000027956.1)
  12. Colobus angolensis palliatus miRNA (ENSCANG00000008487.1)
  13. Dasypus novemcinctus miRNA (ENSDNOG00000032582.1)
  14. Equus asinus asinus (donkey) miRNA (ENSEASG00005020319.1)
  15. Equus asinus (ass) microRNA 199b (ENSEASG00005020319.2)
  16. Equus caballus microRNA 199b (ENSECAG00000026354.2)
  17. Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000003236.1)
  18. Gorilla gorilla gorilla microRNA 199b (ENSGGOG00000037753.1)
  19. Loxodonta africana microRNA 199b (ENSLAFG00000024402.2)
  20. Macaca fascicularis (Crab-eating macaque) microRNA 199b (ENSMFAG00000013677.2)
  21. Macaca mulatta (Macaque) microRNA 199b (ENSMMUG00000046294.2)
  22. Macaca nemestrina miRNA (ENSMNEG00000020822.1)
  23. Mandrillus leucophaeus miRNA (ENSMLEG00000011200.1)
  24. Mustela putorius furo (Domestic ferret) miRNA (ENSMPUG00000022140.1)
  25. Neogale vison (American mink) miRNA (ENSNVIG00000011145.1)
  26. Nomascus leucogenys microRNA 199b (ENSNLEG00000019508.2)
  27. Octodon degus (Degu) miRNA (ENSODEG00000022055.1)
  28. Pan paniscus microRNA 199b (ENSPPAG00000008228.1)
  29. Pan troglodytes ptr-mir-199b (ENSPTRG00000027836.2, ENSPTRG00000052220.1)
  30. Papio anubis (olive baboon) miRNA (ENSPANG00000007755.3)
  31. Piliocolobus tephrosceles miRNA (ENSPTEG00000014155.1)
  32. Pongo abelii miRNA (ENSPPYG00000022251.2)
  33. Procavia capensis (cape rock hyrax) miRNA (ENSPCAG00000019310.1)
  34. Rhinopithecus bieti miRNA (ENSRBIG00000004651.1)
  35. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000037053.1)
  36. Suricata suricatta microRNA 199b (ENSSSUG00005011353.1)
  37. Theropithecus gelada (gelada) microRNA 199b (ENSTGEG00000020698.1)
  38. Ursus americanus miRNA (ENSUAMG00000020271.1)
  39. Ursus maritimus miRNA (ENSUMAG00000022709.1)
  40. Ursus thibetanus thibetanus microRNA 199b (ENSUTTG00000009687.1)
  41. Vulpes vulpes (red fox) miRNA (ENSVVUG00000013417.1)
  42. Zalophus californianus miRNA (ENSZCAG00015022322.1)
Publications