Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Capra hircus (goat) microRNA chi-mir-99b precursor secondary structure diagram

Capra hircus (goat) microRNA chi-mir-99b precursor URS000075E904_9925

Automated summary: This pre miRNA sequence is 70 nucleotides long and is found in Capra hircus. Annotated by 3 databases (Ensembl, miRBase, RefSeq). Described in 4 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-10, RF00104). Capra hircus (goat) microRNA chi-mir-99b precursor sequence is a product of ENSCHIG00000000985.1, 99, 99b, mir-99b, MIR99B genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGCACCCACCCGUAGAACCGACCUUGCGGGGCCUUCGCCGCACACAAGCUCGUGUCUGUGGGUCCGUGUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 72 other species

    1. Aotus nancymaae miRNA (ENSANAG00000004660.1)
    2. Bos taurus (cattle) microRNA bta-mir-99b precursor
    3. Carlito syrichta miRNA (ENSTSYG00000031395.1)
    4. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000010657.1)
    5. Chlorocebus sabaeus miRNA (ENSCSAG00000026382.1)
    6. Colobus angolensis palliatus miRNA (ENSCANG00000009063.1)
    7. Cricetulus griseus (Chinese hamster) microRNA cgr-mir-99b precursor
    8. Dipodomys ordii miRNA (ENSDORG00000022048.2)
    9. Equus caballus microRNA eca-mir-99b precursor
    10. Gorilla gorilla gorilla microRNA 99b (ENSGGOG00000029280.2)
    11. Homo sapiens (human) microRNA hsa-mir-99b precursor
    12. Loxodonta africana (African savanna elephant) microRNA 99b (ENSLAFG00000028953.1)
    13. Macaca fascicularis (Crab-eating macaque) miRNA
    14. Macaca mulatta microRNA mml-mir-99b precursor
    15. Macaca nemestrina miRNA (ENSMNEG00000012620.1)
    16. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000001809.1)
    17. Mesocricetus auratus miRNA (ENSMAUG00000003642.1)
    18. Microcebus murinus (gray mouse lemur) miRNA (ENSMICG00000032686.2)
    19. Microtus ochrogaster (vole) microRNA 99b (ENSMOCG00000009873.1)
    20. Mus caroli (Ryukyu mouse) microRNA 99b (MGP_CAROLIEiJ_G0007529.1)
    21. Mus musculus microRNA mmu-mir-99b precursor
    22. Mus pahari (Shrew mouse) microRNA 99b (MGP_PahariEiJ_G0007220.1)
    23. Mus spretus microRNA 99b (MGP_SPRETEiJ_G0007896.1)
    24. Nannospalax galili miRNA (ENSNGAG00000006296.1)
    25. Nomascus leucogenys miRNA (ENSNLEG00000026046.2)
    26. Otolemur garnettii miRNA (ENSOGAG00000025334.1)
    27. Pan paniscus miRNA (ENSPPAG00000017218.1)
    28. Pan troglodytes (chimpanzee) ptr-mir-99b (ENSPTRG00000027768.2)
    29. Papio anubis miRNA (ENSPANG00000027146.2)
    30. Pongo abelii (Sumatran orangutan) miRNA
    31. Procavia capensis miRNA (ENSPCAG00000019155.1)
    32. Propithecus coquereli miRNA (ENSPCOG00000008490.1)
    33. Pteropus vampyrus miRNA (ENSPVAG00000026914.1)
    34. Rattus norvegicus microRNA rno-mir-99b precursor
    35. Rhinopithecus bieti miRNA (ENSRBIG00000008974.1)
    36. Rhinopithecus roxellana miRNA (ENSRROG00000011788.1)
    37. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000016203.1)
    38. Sus scrofa microRNA ssc-mir-99b precursor
    39. Tursiops truncatus miRNA (ENSTTRG00000023194.1)
    2D structure New