Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-99b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-99b precursor URS000075E904_9606

  • 70 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 38 species

Automated summary: This pre miRNA sequence is 70 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (ENA, HGNC, miRBase, Ensembl/GENCODE, MalaCards, RefSeq, Ensembl, GeneCards). Described in 34 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-10, RF00104). Homo sapiens (human) microRNA hsa-mir-99b precursor sequence is a product of hsa-mir-99b precursor, mir-99b precursor, mir-99b precurso, MIR99B, mir-99b genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGCACCCACCCGUAGAACCGACCUUGCGGGGCCUUCGCCGCACACAAGCUCGUGUCUGUGGGUCCGUGUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 37 other species

    1. Aotus nancymaae miRNA
    2. Bos taurus (cattle) microRNA bta-mir-99b precursor
    3. Capra hircus (goat) microRNA chi-mir-99b precursor
    4. Carlito syrichta (Philippine tarsier) miRNA
    5. Cercocebus atys (Sooty mangabey) miRNA
    6. Chlorocebus sabaeus (African green monkey) miRNA
    7. Colobus angolensis palliatus miRNA
    8. Cricetulus griseus (Chinese hamster) microRNA cgr-mir-99b precursor
    9. Dipodomys ordii miRNA
    10. Equus caballus (horse) microRNA eca-mir-99b precursor
    11. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 99b
    12. Loxodonta africana microRNA 99b
    13. Macaca fascicularis (Crab-eating macaque) miRNA
    14. Macaca mulatta microRNA mml-mir-99b precursor
    15. Macaca nemestrina miRNA
    16. Mandrillus leucophaeus (Drill) miRNA
    17. Mesocricetus auratus (Golden Hamster) miRNA
    18. Microcebus murinus miRNA
    19. Microtus ochrogaster microRNA 99b
    20. Mus caroli microRNA 99b
    21. Mus musculus (house mouse) microRNA mmu-mir-99b precursor
    22. Mus pahari microRNA 99b
    23. Mus spretus microRNA 99b
    24. Nannospalax galili miRNA
    25. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    26. Otolemur garnettii (small-eared galago) miRNA
    27. Pan paniscus (bonobo) miRNA
    28. Pan troglodytes (chimpanzee) ptr-mir-99b
    29. Papio anubis (Olive baboon) miRNA
    30. Pongo abelii miRNA
    31. Procavia capensis (cape rock hyrax) miRNA
    32. Propithecus coquereli (Coquerel's sifaka) miRNA
    33. Pteropus vampyrus miRNA
    34. Rattus norvegicus microRNA rno-mir-99b precursor
    35. Rhinopithecus bieti miRNA
    36. Rhinopithecus roxellana miRNA
    37. Saimiri boliviensis boliviensis miRNA
    38. Sus scrofa (pig) microRNA ssc-mir-99b precursor
    39. Tursiops truncatus (bottlenosed dolphin) miRNA
    2D structure New