Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000025334.1) secondary structure diagram

Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000025334.1) URS000075E904_30611

Automated summary: This pre miRNA sequence is 70 nucleotides long and is found in Otolemur garnettii. Annotated by 1 database (Ensembl). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-10, RF00104). Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000025334.1) sequence is a product of ENSOGAG00000025334.1 gene. Found in the small-eared galago reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGCACCCACCCGUAGAACCGACCUUGCGGGGCCUUCGCCGCACACAAGCUCGUGUCUGUGGGUCCGUGUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 72 other species

    1. Aotus nancymaae miRNA (ENSANAG00000004660.1)
    2. Bos taurus (cattle) microRNA bta-mir-99b precursor
    3. Capra hircus microRNA chi-mir-99b precursor
    4. Carlito syrichta miRNA (ENSTSYG00000031395.1)
    5. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000010657.1)
    6. Chlorocebus sabaeus miRNA (ENSCSAG00000026382.1)
    7. Colobus angolensis palliatus miRNA (ENSCANG00000009063.1)
    8. Cricetulus griseus (Chinese hamster) microRNA cgr-mir-99b precursor
    9. Dipodomys ordii miRNA (ENSDORG00000022048.2)
    10. Equus caballus microRNA eca-mir-99b precursor
    11. Gorilla gorilla gorilla microRNA 99b (ENSGGOG00000029280.2)
    12. Homo sapiens (human) microRNA hsa-mir-99b precursor
    13. Loxodonta africana (African savanna elephant) microRNA 99b (ENSLAFG00000028953.1)
    14. Macaca fascicularis (Crab-eating macaque) miRNA
    15. Macaca mulatta microRNA mml-mir-99b precursor
    16. Macaca nemestrina miRNA (ENSMNEG00000012620.1)
    17. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000001809.1)
    18. Mesocricetus auratus miRNA (ENSMAUG00000003642.1)
    19. Microcebus murinus (gray mouse lemur) miRNA (ENSMICG00000032686.2)
    20. Microtus ochrogaster (vole) microRNA 99b (ENSMOCG00000009873.1)
    21. Mus caroli (Ryukyu mouse) microRNA 99b (MGP_CAROLIEiJ_G0007529.1)
    22. Mus musculus microRNA mmu-mir-99b precursor
    23. Mus pahari (Shrew mouse) microRNA 99b (MGP_PahariEiJ_G0007220.1)
    24. Mus spretus microRNA 99b (MGP_SPRETEiJ_G0007896.1)
    25. Nannospalax galili miRNA (ENSNGAG00000006296.1)
    26. Nomascus leucogenys miRNA (ENSNLEG00000026046.2)
    27. Pan paniscus miRNA (ENSPPAG00000017218.1)
    28. Pan troglodytes (chimpanzee) ptr-mir-99b (ENSPTRG00000027768.2)
    29. Papio anubis miRNA (ENSPANG00000027146.2)
    30. Pongo abelii (Sumatran orangutan) miRNA
    31. Procavia capensis miRNA (ENSPCAG00000019155.1)
    32. Propithecus coquereli miRNA (ENSPCOG00000008490.1)
    33. Pteropus vampyrus miRNA (ENSPVAG00000026914.1)
    34. Rattus norvegicus microRNA rno-mir-99b precursor
    35. Rhinopithecus bieti miRNA (ENSRBIG00000008974.1)
    36. Rhinopithecus roxellana miRNA (ENSRROG00000011788.1)
    37. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000016203.1)
    38. Sus scrofa microRNA ssc-mir-99b precursor
    39. Tursiops truncatus miRNA (ENSTTRG00000023194.1)
    2D structure New