Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus (house mouse) microRNA mmu-mir-181c precursor secondary structure diagram

Mus musculus (house mouse) microRNA mmu-mir-181c precursor URS000075E883_10090

Automated summary: This pre miRNA sequence is 89 nucleotides long and is found in Mus musculus. Annotated by 6 databases (ENA, MGI, miRBase, Ensembl/GENCODE, RefSeq, Ensembl). Described in 29 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-181, RF00076). Mus musculus (house mouse) microRNA mmu-mir-181c precursor sequence is a product of mmu-mir-181c precursor, mir-181c, mir-181c precursor, Mir181c, mir-181c precurso genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GCCAAGGGUUUGGGGGAACAUUCAACCUGUCGGUGAGUUUGGGCAGCUCAGACAAACCAUCGACCGUUGAGUGGACCCCGAGGCCUGGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 6 other species

    1. Cricetulus griseus (Chinese hamster) microRNA 181c
    2. Microtus ochrogaster microRNA 181c
    3. Mus caroli microRNA 181c
    4. Mus pahari microRNA 181c
    5. Mus spretus microRNA 181c
    6. Mustela putorius furo (Domestic ferret) microRNA 181c
    7. Neovison vison microRNA 181c
    2D structure New