Nannospalax galili (Upper Galilee mountains blind mole rat) microRNA 19a (ENSNGAG00000006840.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nannospalax galili (Upper Galilee mountains blind mole rat) microRNA 19a (ENSNGAG00000006840.1) URS000075E79E_1026970

82 nucleotides
1 database (Ensembl)
Found in 8 other species
127 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GCAGCCCUCUGUUAGUUUUGCAUAGUUGCACUACAAGAAGAAUGUAGUUGUGCAAAUCUAUGCAAAACUGAUGGUGGCCUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Microtus ochrogaster microRNA 19a (ENSMOCG00000008544.1)
Mus caroli microRNA 19a (MGP_CAROLIEiJ_G0007398.1)
Mus musculus microRNA mmu-mir-19a precursor
Mus pahari microRNA 19a (MGP_PahariEiJ_G0007745.1)
Mus spicilegus (steppe mouse) microRNA 19a (ENSMSIG00000025224.1)
Mus spretus microRNA 19a (MGP_SPRETEiJ_G0007759.1)
Peromyscus maniculatus bairdii (Northern American deer mouse) microRNA 19a (ENSPEMG00000003505.2)

Publications