Nannospalax galili (Upper Galilee mountains blind mole rat) microRNA 3071 (ENSNGAG00000005727.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nannospalax galili (Upper Galilee mountains blind mole rat) microRNA 3071 (ENSNGAG00000005727.1) URS000075E785_1026970

80 nucleotides
1 database (Ensembl)
Found in 8 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GAACCCUCUGAAGACUCAUUUGAGACGAUGAUGGAGCUUAAGAAUCCAUCAUCAAAACAAAUGGAGUCCUCCGAGGGCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Cricetulus griseus (Chinese hamster) miRNA (ENSCGRG00000021427.1, ENSCGRG00001002428.1)
Dipodomys ordii miRNA (ENSDORG00000026641.1)
Mesocricetus auratus (Golden Hamster) microRNA 3071 (ENSMAUG00000006244.1)
Microtus ochrogaster microRNA 3071 (ENSMOCG00000008852.1)
Mus caroli microRNA 3071 (MGP_CAROLIEiJ_G0007253.1)
Mus musculus microRNA mmu-mir-3071 precursor
Mus pahari microRNA 3071 (MGP_PahariEiJ_G0007644.1)
Mus spretus microRNA 3071 (MGP_SPRETEiJ_G0007598.1)