Bison bison bison (American bison) microRNA 192 (ENSBBBG00000019598.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bison bison bison (American bison) microRNA 192 (ENSBBBG00000019598.1) URS000075E761_43346

106 nucleotides
1 database (Ensembl)
Found in 3 other species
93 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

AGACCGAGUGCACAGGGCUCUGACCUAUGAAUUGACAGCCAGUGCUCUUGUGUCCCCUCUGGCUGCCAAUUCCAUAGGUCACAGGUAUGUUCGCCUCAAUGCCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Bos indicus x Bos taurus (hybrid cattle) miRNA (ENSBIXG00000009521.1, ENSBIXG00005007012.1)
Bos taurus microRNA bta-mir-192 precursor

Publications