Automated summary: This pre miRNA sequence is 109 nucleotides long and is found in Apis mellifera. Annotated by 4 databases (miRBase, Ensembl Metazoa, RefSeq, ENA). Apis mellifera (honey bee) microRNA ame-mir-3723 precursor sequence is a product of ame-mir-3723 precursor, Mir3723, GeneID_100629110, mir-3723 precursor, mir-3723 precurso, 3723, mir-3723 genes. Found in the honey bee reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GACCGGAAGUCACUAUUUUCGGAGUUACAGCGUUUCAAAGUUUUCGUAAAUGUAAAUGUUUAAAAAUCGGAAACCCUUUGUUUCACACGACGAUAUCUCCGGAACCGGA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.