Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) microRNA dre-mir-737 precursor URS000075E708_7955

Automated summary: This pre miRNA sequence is 96 nucleotides long and is found in Danio rerio. Annotated by 3 databases (miRBase, RefSeq, ENA). Matches 1 Rfam family (mir-737, RF03956). Danio rerio (zebrafish) microRNA dre-mir-737 precursor sequence is a product of dre-mir-737 precursor, mir-737 precursor, mir-737, mir-737 precurso, mir737 genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CCACAGCUGCUGUGCUGUUGUUUUUUUAGGUUUUGAUUUUUGUGAAAUGUCGAUGAGAAAAUCAAAACCUAAAGAAAAUACUGCGCAGAUAGAUGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.