Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-6891 precursor URS000075E69A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR6891: MIR6891 is an RNA gene that belongs to the miRNA class [PMC9569480]. It is located on chromosome 6 and is associated with other genes such as HLA-B, LOC101929072, MICA, LINC01149, HCP5, HCG26, MICB, MCCD1, and DDX39B [PMC9746098]. Several SNPs have been identified for MIR6891 and other miRNAs [PMC7044681]. There is a link between locus 6p21 and IgA levels through the association of rs3131294 with serum IgA levels [PMC9584840]. The risk allele A of rs3131294 is associated with increased expression of MIR6891 in whole blood and lung tissues [PMC9584840]. Rs3131294 also affects the expression of several COVID-19 candidate genes including AGER, complement system genes (C4A, C4B, CFB), antigen-processing genes (MHC class II genes), and NOTCH4 [PMC9584840]. MIR6891 is also identified as one of the vagina-specific eQTL-related genes [PMC8407429]. Rs2523589 has an impact on the expression levels of multiple candidate genes including MIR6891 in GTEx data [PMC7733486]. The location of MIR6891 within an HLA-B intron suggests a possible link between miR-6891-5p expression and HLA-B gene regulation [PMC9641602]. Rs4285314 presents a challenge in distinguishing its effect from that of HLA-B variants within the same susceptibility locus as MIR6891 variants [PMC10061723]. Experimental validation is needed to confirm predicted changes in MIR6891 and other target genes due to limitations in microRNA-target prediction algorithms [PMC10061723]. The seed SNP rs2276448 within MIR6891 has potential regulatory effects on its target function compared to other SNPs within the microRNA sequence regions [PMC10061723]. The association between MIR6891 and macrophage-driven inflammation suggests a potential role in MS [PMC10061723].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUAAGGAGGGGGAUGAGGGGUCAUAUCUCUUCUCAGGGAAAGCAGGAGCCCUUCAGCAGGGUCAGGGCCCCUCAUCUUCCCCUCCUUUCCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications