Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryzias latipes (Japanese medaka) ola-miR-125a-5p URS000075E604_8090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCUGAGACCCUUAACCUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Anolis carolinensis (green anole) aca-miR-125a-5p
  2. Chrysemys picta (Painted turtle) cpi-miR-125a-5p
  3. Danio rerio (zebrafish) dre-miR-125a
  4. Haplochromis burtoni abu-miR-125a
  5. Ictalurus punctatus (channel catfish) ipu-miR-125a
  6. Maylandia zebra mze-miR-125a
  7. Monopterus albus (swamp eel) Mal-Mir-10-P3b2_5p (mature (guide))
  8. Neolamprologus brichardi (lyretail cichlid) nbr-miR-125a
  9. Ophiophagus hannah oha-miR-125a-5p
  10. Oreochromis niloticus (Nile tilapia) oni-miR-125a
  11. Pundamilia nyererei pny-miR-125a
  12. Takifugu rubripes fru-miR-125a
  13. Tetraodon nigroviridis tni-miR-125a
  14. Tor tambroides (Thai mahseer) miR-125a
  15. Xenopus tropicalis xtr-miR-125a
Publications