Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1206 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1206 precursor URS000075E581_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1206: MIR1206 is a microRNA that is encoded by the PVT1 gene and has been reported to exhibit oncogenic properties [PMC9191314]. PVT1 generates a diverse assortment of alternatively spliced RNAs as well as multiple microRNAs, including MIR1206 [PMC6160183]. The MYC gene breakpoints were mapped to the PVT1 locus that harbors MIR1206 [PMC2739276]. Coamplification of MYC and PVT1 has been shown to correlate with rapid progression of breast cancer and poor clinical survival [PMC6160183]. MIR1206 is part of a cluster of miRNAs within the PVT1 genomic DNA region, and its regulatory functions within the MYC-PVT1 locus are still being investigated [PMC4172193]. It has been suggested that MIR1206 may act as RNA interference, potentially connected to PAG1 [PMC7846894]. The MIR1206 rs2114358 AG-GG genotypes have shown a reduced risk of chronic lymphocytic leukemia (CLL) [PMC4368096]. This variant may alter the maturation and secondary structure of MIR1206, potentially affecting its function in cancer development [PMC4368096]. Overexpression of the PVT1 transcript, including MIR1206, has been observed in various tumor tissues [PMC4368096]. The chromosomal location of MIR1206 at 8q24.2 is frequently associated with cancer-related chromosomal breaks and genomic instability [PMC4368096]. In relation to gastric cancer (GC), rs2114358 in the precursor sequence of MIR1206 has shown an inverse association with non-cardia adenocarcinoma risk but not cardia adenocarcinoma risk. Additionally, other miRNA single nucleotide variants (SNVs) have also been associated with GC risk [PMC6687864]. In conclusion, MIR1206, encoded by the PVT1 gene, is a microRNA with potential oncogenic properties and is implicated in various cancers, including breast cancer, CLL, and GC [PMC9191314][PMC6160183][PMC2739276][PMC4172193][PMC7846894][PMC4368096][PMC6687864].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUGUUCAUGUAGAUGUUUAAGCUCUUGCAGUAGGUUUUUGCAAGCUAGUGAACGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes miRNA
2D structure Publications