v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus pahari (Shrew mouse) microRNA 196a-2 (MGP_PahariEiJ_G0007038.1) URS000075E574_10093

Automated summary: This pre miRNA sequence is 85 nucleotides long and is found in Mus pahari. Annotated by 1 database (Ensembl). Matches 1 Rfam family (mir-196, RF00256). Mus pahari (Shrew mouse) microRNA 196a-2 (MGP_PahariEiJ_G0007038.1) sequence is a product of MGP_PahariEiJ_G0007038.1 gene. Found in the Mus pahari reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    AGCUGAUCUGUGGCUUAGGUAGUUUCAUGUUGUUGGGAUUGAGUUUUGAACUCGGCAACAAGAAACUGCCUGAGUUACAUCAGUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 20 other species

    1. Bos taurus microRNA bta-mir-196a precursor (bta-mir-196a-2)
    2. Castor canadensis (American beaver) microRNA 196a-2 (ENSCCNG00000009616.1)
    3. Cavia aperea (Brazilian guinea pig) microRNA 196a-2 (ENSCAPG00000000738.1)
    4. Cavia porcellus (domestic guinea pig) microRNA 196a-2 (ENSCPOG00000022593.2)
    5. Chinchilla lanigera microRNA 196a-2 (ENSCLAG00000021133.1)
    6. Cricetulus griseus microRNA 196a-2 (ENSCGRG00000021294.1, ENSCGRG00001007514.1)
    7. Dipodomys ordii (Ord's kangaroo rat) microRNA 196a-2 (ENSDORG00000027594.1)
    8. Fukomys damarensis miRNA (ENSFDAG00000020427.1)
    9. Heterocephalus glaber microRNA 196a-2 (ENSHGLG00000022577.1, ENSHGLG00100023543.1)
    10. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA 196a-2 (ENSSTOG00000019771.2)
    11. Mesocricetus auratus microRNA 196a-2 (ENSMAUG00000005201.1)
    12. Microtus ochrogaster (vole) microRNA 196a-2 (ENSMOCG00000006326.1)
    13. Mus caroli microRNA 196a-2 (MGP_CAROLIEiJ_G0007468.1)
    14. Mus musculus (house mouse) microRNA mmu-mir-196a precursor (mmu-mir-196a-2)
    15. Mus spretus microRNA 196a-2 (MGP_SPRETEiJ_G0007832.1)
    16. Nannospalax galili microRNA 196a-2 (ENSNGAG00000009305.1)
    17. Octodon degus microRNA 196a-2 (ENSODEG00000021815.1)
    18. Ovis aries (sheep) miRNA (ENSOARG00000023497.1)
    19. Tupaia belangeri (northern tree shrew) microRNA 196a-2 (ENSTBEG00000017829.1)
    20. Tursiops truncatus microRNA 196a-2 (ENSTTRG00000022751.1)