Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-372 precursor URS000075E430_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR372: MIR372 is a microRNA that has been found to play a role in tumor development and progression [PMC5564752]. In a study, it was observed that the binding of the P21(WAF1/Cip1) protein to the Pim1 promoter DNA probe was significantly reduced in cells treated with pCMV6-AC-GFP-JMJD2A, rLV-JMJD2AΔ, and rLV-JMJD2AΔ plus MIR372 inhibitor compared to control cells [PMC5564752]. This suggests that MIR372 may be involved in regulating the activity of JMJD2A, a protein associated with tumor growth [PMC5564752]. In fact, combining JMJD2A knockdown with blocking MIR372 has shown promise as a potential treatment strategy for tumors with over-activated JMJD2A [PMC5564752]. Additionally, MIR372 has been implicated in the silencing of LATS2 expression, which is a tumor suppressor gene involved in the Hippo pathway. This silencing has been observed in testicular germ cell tumors [PMC8063430]. These findings highlight the potential significance of MIR372 as a therapeutic target for cancer treatment and suggest its involvement in multiple pathways related to tumor development and progression [PMC5564752][PMC8063430].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGGGCCUCAAAUGUGGAGCACUAUUCUGAUGUCCAAGUGGAAAGUGCUGCGACAUUUGAGCGUCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Publications