Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4278 precursor URS000075E415_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4278: MIR4278 is a microRNA that has been identified in various studies. It is one of the small non-coding transcripts that have been associated with cancer pathogenesis [PMC8138064]. MIR4278, along with MIR4422 and MIR4779, has been reported to have a role as tumor suppressors and can induce apoptosis and cell cycle arrest [PMC8138064]. These microRNAs have also been associated with overall cancer survival [PMC8138064]. Analyses of the putative regulation of target genes for the overexpressed microRNAs in NR (MIR4278, MIR4422, MIR4779, MIR1268B) revealed a total of 411 interactions [PMC8138064]. Among these interactions, 16 genes were found to be potentially regulated by MIR4278, MIR4422, and MIR4779 [PMC8138064]. One of these genes is located in a deletion region (5p15.31-p15.33) that encompasses approximately 2.89 Mb and includes LOC340094, ADAMTS16, KIAA0947, FLJ33360, MED10, UBE2QL1, LOC255167 NSUN2 SRD5A1 PAPD7 and MIR4278 [PMC4838791]. Furthermore, it has been found that specific ancestries may be driving the trans-ancestry discovery at loci near LINC00885 and MIR4278 [PMC7610958][PMC9562672].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCUAACACCAGGAGAAUCCCAUAGAACAUUGACAUCAACACUAGGGGGUUUGCCCUUGUGGGGAAGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications