Automated summary: This pre miRNA sequence is 66 nucleotides long and is found in Mus musculus. Annotated by 5 databases (miRBase, ENA, MGI, Ensembl, RefSeq). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-344, RF00825). Mus musculus (house mouse) microRNA mmu-mir-344e precursor sequence is a product of mir-344e precurso, mir-344e precursor, Mir344e, mir-344e, mmu-mir-344e precursor, ENSMUSG00000077869.3 genes. Found in the mouse reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
CAGUCAGGCUUCUGGCUAUAUUCCAGGACUUACCUGGUCCUGGAUAUAACCAAAGCCUGACUAUAU
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.