Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4675 precursor URS000075E335_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4675: MIR4675 is a microRNA that has been implicated in various cancers [PMC8147355]. In a study, nine genes, including MIR4675, were found to be previously implicated in cancers at other sites [PMC8147355]. In another study, it was found that MIR4675 is located in the intergenic region along with other genes [PMC7519073]. Additionally, MIR4675 has been reported to be a susceptible microRNA for eosinophilic esophagitis risk [PMC8226327]. Further research is needed to establish the role of MIR4675 and CNVR2239.1 in lung cancer [PMC8226327]. CNVR2239.1 may encompass the entire DNA sequence of MIR4675 and not just the promoter region, potentially leading to changes in gene dosage effect on MIR4675 expression [PMC8226327]. References: - [PMC8147355]: www.proteinatlas.org accessed on 2019–2020 - [PMC7519073]: Not provided - [PMC8226327]: Not provided

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUGAGAAAUCCUGCUGGUCAACCAUAGCCCUGGUCAGACUCUCCGGGGCUGUGAUUGACCAGCAGGACUUCUCAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications