Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus (house mouse) microRNA mmu-mir-183 precursor secondary structure diagram

Mus musculus (house mouse) microRNA mmu-mir-183 precursor URS000075E1B6_10090

Automated summary: This pre miRNA sequence is 70 nucleotides long and is found in Mus musculus. Annotated by 6 databases (RefSeq, MGI, Ensembl, miRBase, Ensembl/GENCODE, ENA). Described in 45 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-183, RF00663). Mus musculus (house mouse) microRNA mmu-mir-183 precursor sequence is a product of Mir183, mir-183, mir-183 precurso, mir-183 precursor, mmu-mir-183 precursor genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUGUGUAUGGCACUGGUAGAAUUCACUGUGAACAGUCUCAGUCAGUGAAUUACCGAAGGGCCAUAAACAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 12 other species

    1. Cavia aperea (Brazilian guinea pig) microRNA 183
    2. Cavia porcellus microRNA 183
    3. Chinchilla lanigera (Long-tailed chinchilla) microRNA 183 (MIR183)
    4. Cricetulus griseus (Chinese hamster) microRNA 183
    5. Fukomys damarensis (Damara mole rat) miRNA
    6. Ictidomys tridecemlineatus microRNA 183 (MIR183)
    7. Mus caroli microRNA 183
    8. Mus spicilegus microRNA 183
    9. Mus spretus microRNA 183
    10. Octodon degus (Degu) microRNA 183 (MIR183)
    11. Pongo abelii miRNA
    12. Procavia capensis (cape rock hyrax) microRNA 183 (MIR183)
    13. Tursiops truncatus (bottlenosed dolphin) microRNA 183
    2D structure New