v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1232 (LINC01232) URS000075E1B1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01232: Long intergenic non-coding RNA LINC01232 has been identified as a critical regulator of pancreatic adenocarcinoma oncogenesis [PMC7595671]. It has been found to promote metastasis in pancreatic cancer [PMC9113486], clear cell renal cell carcinoma [PMC9705925], and esophageal squamous cell carcinoma [PMC10084753]. However, its role in gastric cancer metastasis has not been reported [PMC6754375]. LINC01232 has been shown to interact directly with EZH2 and target tumor suppressors such as p21, p53, KLF2, and LATS2 [PMC9705925]. Inhibition of miR-654-3p in cells with LINC01232 silencing was found to rescue its effects [PMC7595671]. Additionally, the downregulation/upregulation of miR-181a-5p attenuated the effects of LINC01232 silencing/overexpression on the proliferation, migration, invasion, and angiogenesis of COAD cells [PMC10084753]. Overexpression of TM9SF2 reversed the influence of LINC01232 depletion on the expression of EMT-relevant proteins [PMC6754375]. Increased levels of LINC01232 have diagnostic accuracy in distinguishing pancreatic adenocarcinoma patients from healthy individuals and predict an unfavorable prognosis in patients with pancreatic adenocarcinoma [PMC7871353]. In transwell assays, downregulation of LINC01232 restrained the migratory and invasive capacities of PANC-1 and SW1990 cells [PMC6754375]. Furthermore, a significant correlation was found between LINC01232 expression levels and tumor size (p = .020), lymph node metastasis (p = .006), and TNM stage (p = .001) in pancreatic adenocarcinoma patients [PMC8604453].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAUUUUAUAAAACCUUGAAAUCCCUUAAUACCACUCGUCUGCUUAAACCUCGGCAUCCCACAUUUACCACUAUCAGGAAGGAUCACGUUUGUUUGUUUGCUGUCUCAUUCCCCCAUUUAUAUGUGAAUUCCACGGGUAAGGGCCUGCUCCUACAUCCCACACCUCUACAUCCACAGAGCCUAGAGACCGCAGGCGCGGGGAAAGCACUCCACGACCAUCACUGGCCAGGCCACAAGAGUGCUGGAUCUAAAUUUGGAACCGGACUUUCAGAGCUGAAAUAAACCUGAGGUUUUCCAGGGGCUUUUAACCUCCUUUUACAGCCAAGGAUGCGCCUAAGAAAGGGGAGAGGCUUCCGUGACUUCCUGCAGUAACGCAGCCACUAGAGAUUGAGACUACAACGACUUGGGAGUCUAAAAGUCUGCAACCUUUUCCACUCCAGAGCUCAAUGUUUCCUCAAUCCCCCGGGAUCGGCAUCAGCAAAAACCCGGAGAAGCGGAGCCUUUCUCAAAGAAAAUGACCUCCAGACUCAUGCUACCAUCUCGACCGGUGCAAGUAUCACGCAUGCGCAGGGCCGGCCGCCCGGCCGCACCUCGCCAACUCCUACUCGGACACGUCAUCUAGAAUAAUUUGGACAGCCUUUUCUGAGUUUCCCAUGACGACUUCUGUAUAAGAUUGUCGGAUAUAGCAAAUAAAAGUACAGUAUACCCAGCUUUACUGUGCGUUUUGUCCAAUUAUUUGUUCAAAACGCCAAGAACCUGGACAACUUGCUGUCCGCAACCAAUCAGACUGAUUGUGGGCUGAAUCUUCAUUUGCAUGGAAGUGCAACUUUGUAACUUCACUUUAGCCUCUGAUUGCGGGCCACCACUUCAUUUACAUGAGUGCGUUUUGUUCAAUUCUUUGUUCAAAACCCCAAGAAUCUGGACAACUUGCACUCAAGACCCUCUACGGGUUUGGCGAGCCAGAGACCAUCAAGCUUCAGAUGAUCAUGUGACAGGGUUUCCAGCCAGUUCCAGGUGAAGACACCACCCCUGGCCAUCAAGAAGUCACCCGGUCUCCACUAGACAGAGUAGGGUGAGAGUUCCGUGAUCUCCAACCGGUAGUGAUUAUGCCCCAAGUCAGCAUAAAGAAGUUACGGAAGAAAAACCAUCAGUCCCUCUGUCUCACAUAAAGACUUAUGGGGAUCACGUUUCUCAGAGGGGAGAUGAGGCAGGAGAAUAGGGUCUGGAGGCAGGGAACCUAAGGCCGUUUCACACUGACUUCUUAGAACUAAAUUGAAAGGAAAACCCUAAUUUUCCAUGCCUAAGUAACAAAAGGACCAGAGGCUACUCCCUUUGCAAACCCCCACCUUUUCUGUGUGGCAUAUGGGAAAUUGAAAGUACCUCUGAUUGAUUGUUUUCUGCAACCAAUCAGAUGUUUGCAUUGGAGUGUAACUUUGUAAUUUCACUUCAGUCUCUGAUUGGUUGCUGCAGUCUGGAAAUUCUGCAGGCCAAGUCUUCGUUUGCAUAGAAGUGCAACUUUGUAACUUCAUCUUAGCCUCUGAUUGGUUGCUUUCUGCAACCAAUCAGAUGUUUGCAUAGGCGUGUGACCUUUGUAACUUCACUUCAGCUUCUGAUUGGUUGCUUUCCACAACCAAUCAGACUGAUUGUGGGCCACCACUUCCUUUACGUGAGGUGAACACCAAGUGGCCAAUGGAAAACCUCAAGAGGGUAUUUGGACCUGAGAAGAUUCUGUAUCUGGGGCCCUUGAGCUGCUGCUCUGCCCACUCUCACAUGGUGGAGUGUAAUUUCACUUUGAAUAAAUCUCUGCUUUUGUUGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications