Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3938 precursor URS000075E1AC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3938: Based on the value of BH-FDR, hsa-mir-3938 and hsa-mir-4780 were selected for further experiments [PMC7368334]. In N2 type neutrophils, hsa-mir-3938 expression decreased significantly, while hsa-mir-4780 expression increased significantly [PMC7368334]. The miRNA-targets networks suggested that the ZNF197 gene regulated by hsa-mir-3938 and hsa-mir-4780 in N2 neutrophils might be associated with tumor cell growth, invasion, metastasis, and the development of colorectal cancer (CRC) [PMC7368334]. The study indicated that the regulation of TUSC1 and ZNF197 by hsa-mir-3938 and hsa-mir-4780 established a theoretical basis for understanding how N2 type neutrophils regulate invasion and metastasis of CRC cells [PMC7368334]. TUSC1 gene in N2 neutrophils might inhibit adhesion, invasion, and metastasis of colorectal cancer cells through downregulation of hsa-mir-3938 expression and upregulation of hsa-miR-4780 expression in the tumor microenvironment [PMC7368334]. The target genes regulated by these miRNAs were listed in Table 2 with 80 target genes regulated by hsa-miR-3938 and 101 target genes regulated by hsa-miR-4780 [PMC7368334]. In addition to TUSC1 and ZNF197, other target genes were also identified to be regulated by these miRNAs [PMC7368334][PMC8167795]. The expression levels of these miRNAs were found to be significantly altered in the neutrophil+TGF-beta1 group compared to the neutrophil group [PMC7368334][PMC8167795]. It is believed that hsa-mir-3938 and hsa-miR-4780 may play a role in regulating the invasion and metastasis of colon cancer through the control of N2-type neutrophils [PMC8167795]. Furthermore, TUSC1 and ZNF197 were identified as targets of hsa-miR-4780 and hsa-mir-3938, respectively [PMC8167795].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGAAUUUUUAACCCGAUCACUAGAUUAUCUACAAGGGAAUUUUUUUUUAAUUUAAAAAAUUCCCUUGUAGAUAACCCGGUGGUCAGGUUGGAUGGCUCCAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications