Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-487b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-487b precursor URS000075E150_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR487B: MIR487B is a microRNA that belongs to the miR655 miRNA cluster and is expressed in various tissues and diseases. It is one of the miRNAs in the cluster that has available expression data [PMC7465874]. MIR487B has been found to be downregulated in gliomas, but its functional role in glial neoplasms has not been explored [PMC5288128]. In an in vivo model of chronic heart failure, MIR487B was found to inhibit the IL-33/ST2 signaling axis, resulting in improved cardiac morphology and reduced collagen expression [PMC8663982]. MIR487B is also part of the DLK1-MEG3 cluster and has been shown to be significantly reduced or silenced by DNA hypermethylation in bladder tumor tissues and cell lines [PMC4348104]. In multiple sclerosis, MIR487B is less expressed in the diseased context [PMC4655260]. Tobacco smoking-induced epigenetic downregulation of MIR487B leads to overexpression of various polycomb group proteins and stem cell-related genes [PMC6116004]. Chromosome 8 contains an expression quantitative trait locus (eQTL) for MIR487B [PMC4755013]. Additionally, elevated levels of MIR487B have been observed in peripheral blood mononuclear cells of patients with stroke [PMC7123062]. Higher expression levels of MIR487B have also been associated with poor survival outcomes based on data from The Cancer Genome Atlas (TCGA) database [PMC5975595]. A-to-I editing and Nm modifications can alter the targets of tumor suppressor microRNA such as MIR487B, promoting angiogenesis. Increased levels of Ψ writers RPUSD3 and RPUSD4 can induce defective assembly of oxidative phosphorylation system proteins [PMC9916637].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGGUACUUGGAGAGUGGUUAUCCCUGUCCUGUUCGUUUUGCUCAUGUCGAAUCGUACAGGGUCAUCCACUUUUUCAGUAUCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

2D structure Publications