Tursiops truncatus (bottlenosed dolphin) microRNA 365a (ENSTTRG00000023573.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tursiops truncatus (bottlenosed dolphin) microRNA 365a (ENSTTRG00000023573.1) URS000075E14A_9739

87 nucleotides
1 database (Ensembl)
Found in 11 other species
8 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

ACCGCAGGGAAAAUGAGGGACUUUUGGGGGCAGAUGUGUUUCCAUUCCGCUAUCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

Balaenoptera musculus microRNA 365a (ENSBMSG00010022071.1)
Castor canadensis (American beaver) miRNA (ENSCCNG00000014042.1)
Cricetulus griseus (Chinese hamster) microRNA mir-365 (ENSCGRG00000021619.1, ENSCGRG00001003274.1, ENSCGRG00015007740.2)
Delphinapterus leucas microRNA 365a (ENSDLEG00000005518.1)
Erinaceus europaeus microRNA 365a (ENSEEUG00000016004.1)
Monodon monoceros (narwhal) microRNA 365a (ENSMMNG00015006489.1)
Mus caroli microRNA 365-1 (MGP_CAROLIEiJ_G0007480.1)
Mus musculus microRNA mmu-mir-365 precursor (mmu-mir-365-1)
Phocoena sinus microRNA 365a (ENSPSNG00000005042.1)
Physeter catodon microRNA 365a (ENSPCTG00005011567.1)

2D structure

Publications