Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) microRNA rno-mir-214 precursor URS000075E0F4_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-214: Rno-mir-214 is a rat microRNA that is a homolog of human hsa-miR-214 [PMC4693154]. In a study, it was found that exposure to certain factors affected the expression of various miRNAs, including rno-mir-214 [PMC5440915]. Rno-mir-214 was predicted to have the maximum number of binding sites within down-regulated pathways [PMC3542345]. It was also predicted to target several down-regulated transcription factors such as Hnf1α, Nfatc4, and Glis2 [PMC3542345]. Rno-mir-214 was found to target genes involved in focal adhesion, chemokine signaling, cell cycle and DNA replication, and Wnt signaling pathways [PMC3542345]. Binding sites of rno-mir-214 were observed as significantly enriched within down-regulated genes in a binding sites overrepresentation analysis [PMC3542345]. The expression of rno-mir-214 was measured in brain tissue and cerebrospinal fluid using a TaqMan MicroRNA assay kit [PMC3568119]. Propofol treatment was found to regulate the expression of rno-miR-19a, rno-miR-137, rno-miR-19b-2, and rno-mir-214 in primary cultured embryonic NSCs [PMC5064799]. Rno-miR-19a, rno-miR-19b2 and rno mir 214 were downregulated at all four time-points following propofol treatment [PMC5064799]. Rho mir 29c miRNA targeted members of the DNAJ heat shock protein family including Acadm and Echs2 targeted by rho mir 18a 5p and rho mir 31a dp respectively were also identified as targets for rho mir 214 [PMC6377737]. Rno-mir-214 was dysregulated in response to certain conditions [PMC5856749]. Rno-mir-214 was identified as a hub in the early IR-injury regulatory network [PMC4424502]. SLC4A1 was predicted to be a potential target gene of rno-mir-214 [PMC5748115].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCCUGGAUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications