Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3944 precursor URS000075DF2F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR3944: MIR3944 is a mirtron that is specifically expressed in patients with dilated cardiomyopathy (drDCM) and not in healthy controls [PMC6292014]. The study found a strong association between drDCM and fatty acid and branched-chain amino acid metabolism, potentially influenced by specific genetic mutations and upregulation of certain genes [PMC6292014]. The results suggest that MIR3944 has the potential to be both a diagnostic and prognostic biomarker for drDCM [PMC6292014]. The expression of MIR3944 in the heart is unusual and indicative of drDCM [PMC6292014].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCACCCAGCAGGCGCAGGUCCUGUGCAGCAGGCCAACCGAGAAGCGCCUGCGUCUCCCAUUUUCGGGCUGGCCUGCUGCUCCGGACCUGUGCCUGAUCUUAAUGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications