Homo sapiens (human) microRNA 320d-2 (ENSG00000221081.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA 320d-2 (ENSG00000221081.1) URS000075DEE6_9606

48 nucleotides
4 databases (ENA, Ensembl, GeneCards, Rfam)
Found in 5 other species
1875 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UUCUCUUCCCAGUUCUUCUUGGAGUCAGGAAAAGCUGGGUUGAGAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 320d-2 (ENSNLEG00000028119.1)
Pan paniscus (bonobo) microRNA 320d-2 (ENSPPAG00000016611.1)
Pan troglodytes ptr-mir-320d-3 (ENSPTRG00000034749.2)
Pongo abelii miRNA
Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-320d precursor (ppy-mir-320d-2)

2D structure

Publications